ID: 1104005695_1104005702

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1104005695 1104005702
Species Human (GRCh38) Human (GRCh38)
Location 12:124890676-124890698 12:124890713-124890735
Sequence CCCACCTTCAGCCTCACCCTCAT CTGTAGACACAAATTGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 672} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!