ID: 1104021699_1104021706

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1104021699 1104021706
Species Human (GRCh38) Human (GRCh38)
Location 12:124996413-124996435 12:124996436-124996458
Sequence CCTGCCTCAGCCTCCTGAGTAGC CGGGATTACAAGTGAGTAGCCGG
Strand - +
Off-target summary {0: 77881, 1: 176222, 2: 210480, 3: 146546, 4: 90715} {0: 1, 1: 0, 2: 1, 3: 6, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!