ID: 1104031934_1104031944

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1104031934 1104031944
Species Human (GRCh38) Human (GRCh38)
Location 12:125071092-125071114 12:125071127-125071149
Sequence CCCGTCCCCAAGAGCTCACTCAC TAGTGCTGGTGGTGGCAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 223} {0: 1, 1: 1, 2: 5, 3: 67, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!