ID: 1104038379_1104038383

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1104038379 1104038383
Species Human (GRCh38) Human (GRCh38)
Location 12:125114165-125114187 12:125114183-125114205
Sequence CCTGAAGCTGGTGGGCCTCCGTG CCGTGGTGCCCTTGATGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 117} {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!