ID: 1104039552_1104039556

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1104039552 1104039556
Species Human (GRCh38) Human (GRCh38)
Location 12:125121000-125121022 12:125121043-125121065
Sequence CCTGTGTACACGCGTACATGTGC CTGGTTCCGTGCCGTAATCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 62} {0: 1, 1: 0, 2: 2, 3: 1, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!