ID: 1104040127_1104040134

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1104040127 1104040134
Species Human (GRCh38) Human (GRCh38)
Location 12:125124396-125124418 12:125124417-125124439
Sequence CCCCAAGATACAATACTCTGCAG AGTTGGGAAGATAATGGGTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155} {0: 1, 1: 0, 2: 0, 3: 19, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!