ID: 1104050010_1104050018

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1104050010 1104050018
Species Human (GRCh38) Human (GRCh38)
Location 12:125188565-125188587 12:125188591-125188613
Sequence CCCCAGCAACAGAAGAGCCTGTG GGCTCTGGAAGGCCCCATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 313} {0: 1, 1: 0, 2: 3, 3: 31, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!