ID: 1104058265_1104058270

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1104058265 1104058270
Species Human (GRCh38) Human (GRCh38)
Location 12:125246728-125246750 12:125246760-125246782
Sequence CCGGCTTTCAGGCACCTATCTTC GTTCCTGTGGACAGAAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 140} {0: 1, 1: 0, 2: 2, 3: 22, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!