ID: 1104063845_1104063851

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1104063845 1104063851
Species Human (GRCh38) Human (GRCh38)
Location 12:125289998-125290020 12:125290044-125290066
Sequence CCCTTAAATCAAAGATATACCAT TGCCGTGTGTGTTTTTCTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 266} {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!