ID: 1104081619_1104081626

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1104081619 1104081626
Species Human (GRCh38) Human (GRCh38)
Location 12:125434809-125434831 12:125434847-125434869
Sequence CCTTTTATTGTAAACCCCTGAAG GCACACTGGTCTGATGCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153} {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!