ID: 1104093729_1104093734

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1104093729 1104093734
Species Human (GRCh38) Human (GRCh38)
Location 12:125537488-125537510 12:125537519-125537541
Sequence CCTTCTAAGTCACCTGGGGCGGA CTTGACAATGGCTGCAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54} {0: 1, 1: 0, 2: 3, 3: 19, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!