ID: 1104094152_1104094155

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1104094152 1104094155
Species Human (GRCh38) Human (GRCh38)
Location 12:125541256-125541278 12:125541287-125541309
Sequence CCTCAACAAATATTTGTTATTGA CTTGAGTTTCAGAAGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 479} {0: 1, 1: 0, 2: 0, 3: 17, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!