ID: 1104104148_1104104155

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1104104148 1104104155
Species Human (GRCh38) Human (GRCh38)
Location 12:125643155-125643177 12:125643182-125643204
Sequence CCAGTTTCTGGCTTGCAAAAGTG TGTGGTGGCCCCACTGGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 30, 4: 194} {0: 1, 1: 0, 2: 5, 3: 24, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!