ID: 1104136260_1104136265

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1104136260 1104136265
Species Human (GRCh38) Human (GRCh38)
Location 12:125941929-125941951 12:125941974-125941996
Sequence CCCTTTCTGATAAATGAAGCTAT AGGATTTTTACATCCTTTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!