ID: 1104187059_1104187062

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1104187059 1104187062
Species Human (GRCh38) Human (GRCh38)
Location 12:126442979-126443001 12:126442997-126443019
Sequence CCAGACCTCAAGAGAGGGTTCCT TTCCTGGACCTCCCACAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 54, 2: 746, 3: 932, 4: 754} {0: 1, 1: 0, 2: 3, 3: 25, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!