ID: 1104252179_1104252186

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1104252179 1104252186
Species Human (GRCh38) Human (GRCh38)
Location 12:127105488-127105510 12:127105518-127105540
Sequence CCTTGATTTCCCAGGCTCAAGCA CACCTCAGCTTCCCGAGTGGCGG
Strand - +
Off-target summary {0: 7, 1: 190, 2: 1262, 3: 4498, 4: 14781} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!