ID: 1104252180_1104252186

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1104252180 1104252186
Species Human (GRCh38) Human (GRCh38)
Location 12:127105497-127105519 12:127105518-127105540
Sequence CCCAGGCTCAAGCAATCCTCCCA CACCTCAGCTTCCCGAGTGGCGG
Strand - +
Off-target summary {0: 2279, 1: 12576, 2: 33112, 3: 64184, 4: 114286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!