ID: 1104252181_1104252186

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1104252181 1104252186
Species Human (GRCh38) Human (GRCh38)
Location 12:127105498-127105520 12:127105518-127105540
Sequence CCAGGCTCAAGCAATCCTCCCAC CACCTCAGCTTCCCGAGTGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 83, 3: 581, 4: 2142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!