ID: 1104365709_1104365713

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1104365709 1104365713
Species Human (GRCh38) Human (GRCh38)
Location 12:128174685-128174707 12:128174705-128174727
Sequence CCCTAGGATGGCACTCTGCCTGC TGCCATGGCAACACCATGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!