ID: 1104367172_1104367175

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104367172 1104367175
Species Human (GRCh38) Human (GRCh38)
Location 12:128188335-128188357 12:128188368-128188390
Sequence CCAAAGTCTCTGTGGAAGGGATC ATAATTATTCTAGTATAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!