ID: 1104381513_1104381518

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1104381513 1104381518
Species Human (GRCh38) Human (GRCh38)
Location 12:128311983-128312005 12:128311997-128312019
Sequence CCAACTTCCAGCTGTGCTGAAAG TGCTGAAAGGGACCCCGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 216} {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!