ID: 1104389988_1104389994

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1104389988 1104389994
Species Human (GRCh38) Human (GRCh38)
Location 12:128384043-128384065 12:128384079-128384101
Sequence CCAAAGAAACCCAAACAAACAAA CAAAACAAAAAGAGGTGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 46, 3: 355, 4: 2478} {0: 1, 1: 0, 2: 5, 3: 53, 4: 715}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!