ID: 1104392772_1104392778

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1104392772 1104392778
Species Human (GRCh38) Human (GRCh38)
Location 12:128405026-128405048 12:128405052-128405074
Sequence CCAGGCTGTCTCCCGTGGCCGTA AACCAGCATTGGACTTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 92} {0: 1, 1: 0, 2: 1, 3: 36, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!