ID: 1104400417_1104400423

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1104400417 1104400423
Species Human (GRCh38) Human (GRCh38)
Location 12:128471485-128471507 12:128471513-128471535
Sequence CCCCTGGCCCTAGGCATAGCTCT AAGACAGGAATATATAAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152} {0: 1, 1: 0, 2: 3, 3: 38, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!