ID: 1104406439_1104406442

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1104406439 1104406442
Species Human (GRCh38) Human (GRCh38)
Location 12:128521193-128521215 12:128521212-128521234
Sequence CCATCCTCAAAGTGATTATCTCT CTCTGTTCTAAGAGACAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225} {0: 1, 1: 0, 2: 2, 3: 15, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!