ID: 1104434605_1104434610

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1104434605 1104434610
Species Human (GRCh38) Human (GRCh38)
Location 12:128745837-128745859 12:128745871-128745893
Sequence CCCCAAAACATCATATGGTTTTG AGAGAGAATGCATGCAGGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 38, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!