ID: 1104440192_1104440198

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1104440192 1104440198
Species Human (GRCh38) Human (GRCh38)
Location 12:128787901-128787923 12:128787946-128787968
Sequence CCACATGAATCCAGTGTGGCCCC AAAGACACTTTGTCCAAATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 20, 3: 246, 4: 1266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!