ID: 1104440195_1104440198 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1104440195 | 1104440198 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 12:128787921-128787943 | 12:128787946-128787968 |
| Sequence | CCCATCTTAACTTGATTCCATCT | AAAGACACTTTGTCCAAATGAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 1, 2: 20, 3: 246, 4: 1266} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||