ID: 1104457731_1104457736

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1104457731 1104457736
Species Human (GRCh38) Human (GRCh38)
Location 12:128929102-128929124 12:128929117-128929139
Sequence CCTTCCACCAAGCGAGGACCTGG GGACCTGGCGAGCATCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 258} {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!