ID: 1104464693_1104464702

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1104464693 1104464702
Species Human (GRCh38) Human (GRCh38)
Location 12:128980691-128980713 12:128980740-128980762
Sequence CCTGGTGGTCTCCAGGGCCGGGG AGCTTTGTGTGGAAGGCAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 304} {0: 1, 1: 0, 2: 3, 3: 39, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!