ID: 1104485537_1104485549

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1104485537 1104485549
Species Human (GRCh38) Human (GRCh38)
Location 12:129148749-129148771 12:129148787-129148809
Sequence CCCTCCTCCACAGCTGCATGCCA CAGAGGCTTCCTGGCAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 413} {0: 1, 1: 0, 2: 1, 3: 62, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!