|
Left Crispr |
Right Crispr |
| Crispr ID |
1104487565 |
1104487568 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:129164485-129164507
|
12:129164515-129164537
|
| Sequence |
CCCAGCTGTATTGGTCCATTTTC |
TATAAAGAACTGCCCAAGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 48, 3: 237, 4: 625} |
{0: 307, 1: 577, 2: 1315, 3: 3452, 4: 8374} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|