ID: 1104491769_1104491775

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1104491769 1104491775
Species Human (GRCh38) Human (GRCh38)
Location 12:129200541-129200563 12:129200572-129200594
Sequence CCATTTGGCTAAACTCTTGGGGT AAAAGCTGATCGGGAGTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 90} {0: 1, 1: 0, 2: 2, 3: 9, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!