ID: 1104492122_1104492133

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1104492122 1104492133
Species Human (GRCh38) Human (GRCh38)
Location 12:129203444-129203466 12:129203487-129203509
Sequence CCCTGCTTCTGTGGGAACTCAGC GGTCCCAGGAAGCATGTGGAGGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 5, 3: 31, 4: 230} {0: 1, 1: 0, 2: 2, 3: 41, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!