ID: 1104492126_1104492133

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1104492126 1104492133
Species Human (GRCh38) Human (GRCh38)
Location 12:129203466-129203488 12:129203487-129203509
Sequence CCAGTGGGTGCAGCCTCCTGTGG GGTCCCAGGAAGCATGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 37, 4: 319} {0: 1, 1: 0, 2: 2, 3: 41, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!