ID: 1104500025_1104500033

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1104500025 1104500033
Species Human (GRCh38) Human (GRCh38)
Location 12:129276131-129276153 12:129276147-129276169
Sequence CCCTCCACCCTCCCTAACCCCTA ACCCCTAAAGGAAATTGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 7, 3: 89, 4: 828} {0: 1, 1: 0, 2: 1, 3: 6, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!