|
Left Crispr |
Right Crispr |
| Crispr ID |
1104524472 |
1104524475 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:129505888-129505910
|
12:129505904-129505926
|
| Sequence |
CCCTCTACCTTAAGTTTATGTGA |
TATGTGAGTCCTTATGTGTTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 331, 2: 463, 3: 348, 4: 397} |
{0: 349, 1: 430, 2: 380, 3: 255, 4: 362} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|