|
Left Crispr |
Right Crispr |
| Crispr ID |
1104524472 |
1104524477 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:129505888-129505910
|
12:129505919-129505941
|
| Sequence |
CCCTCTACCTTAAGTTTATGTGA |
GTGTTAGGTGAGTCTCTTGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 331, 2: 463, 3: 348, 4: 397} |
{0: 88, 1: 291, 2: 250, 3: 151, 4: 243} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|