ID: 1104527702_1104527703

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1104527702 1104527703
Species Human (GRCh38) Human (GRCh38)
Location 12:129539754-129539776 12:129539792-129539814
Sequence CCTTGGATTAAAGGATACTACTG GCTTTGATCACAGATCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 276} {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!