ID: 1104547823_1104547828

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1104547823 1104547828
Species Human (GRCh38) Human (GRCh38)
Location 12:129728139-129728161 12:129728187-129728209
Sequence CCCTCAAGAATGTCCCACATCAA CTGAATATAAAGAATGCAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 238} {0: 1, 1: 0, 2: 0, 3: 34, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!