ID: 1104548074_1104548078

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1104548074 1104548078
Species Human (GRCh38) Human (GRCh38)
Location 12:129730689-129730711 12:129730713-129730735
Sequence CCTCATTCTCGGTGGGCACCATC AATCAGCTGCCAGCACGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 458, 3: 1015, 4: 1325} {0: 16, 1: 99, 2: 144, 3: 196, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!