ID: 1104556897_1104556903

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1104556897 1104556903
Species Human (GRCh38) Human (GRCh38)
Location 12:129808709-129808731 12:129808743-129808765
Sequence CCTTTCAGCTCTGATAGGTCATA CAGAATGAACAAAGGCGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94} {0: 1, 1: 0, 2: 4, 3: 40, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!