ID: 1104561557_1104561562

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1104561557 1104561562
Species Human (GRCh38) Human (GRCh38)
Location 12:129850049-129850071 12:129850093-129850115
Sequence CCCATATATTTGTGGATTTGAAA TCTTTCTGAAGGTATTTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 453} {0: 1, 1: 0, 2: 1, 3: 31, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!