ID: 1104563380_1104563396

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1104563380 1104563396
Species Human (GRCh38) Human (GRCh38)
Location 12:129858964-129858986 12:129859012-129859034
Sequence CCGGGGGAACGGGATGGGTGCCC TGCCCTAGTAACGGAGTCCGGGG
Strand - +
Off-target summary {0: 91, 1: 20, 2: 1, 3: 14, 4: 145} {0: 1, 1: 35, 2: 45, 3: 31, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!