ID: 1104616626_1104616634

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1104616626 1104616634
Species Human (GRCh38) Human (GRCh38)
Location 12:130275783-130275805 12:130275829-130275851
Sequence CCATCCTTCTTGGGCAGGTTATG ATGGTACCTTGCTCATGGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!