ID: 1104630539_1104630546

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1104630539 1104630546
Species Human (GRCh38) Human (GRCh38)
Location 12:130397730-130397752 12:130397758-130397780
Sequence CCCCAGACATAAATGTGTGGGTT TCTCTGTCTCGAGGGAGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 173} {0: 1, 1: 0, 2: 0, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!