ID: 1104648198_1104648209

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1104648198 1104648209
Species Human (GRCh38) Human (GRCh38)
Location 12:130511917-130511939 12:130511966-130511988
Sequence CCACCTCTGGGCTTCCTGAGCAC CAAGCTCAGGCTTCTGTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 473} {0: 1, 1: 0, 2: 1, 3: 21, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!