ID: 1104653086_1104653088

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1104653086 1104653088
Species Human (GRCh38) Human (GRCh38)
Location 12:130551637-130551659 12:130551676-130551698
Sequence CCTGTGTCCAATTTATAGAATTG GAAAATGCACAGATAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148} {0: 1, 1: 0, 2: 1, 3: 55, 4: 562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!