ID: 1104655573_1104655578

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1104655573 1104655578
Species Human (GRCh38) Human (GRCh38)
Location 12:130571828-130571850 12:130571844-130571866
Sequence CCCACACTGGCCTCCCTGTGGCC TGTGGCCCCCTCACACACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 437} {0: 1, 1: 0, 2: 0, 3: 35, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!