ID: 1104655642_1104655645

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1104655642 1104655645
Species Human (GRCh38) Human (GRCh38)
Location 12:130572116-130572138 12:130572133-130572155
Sequence CCAGTGCGTGAAACAGCATGGCC ATGGCCAGGAGTTATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96} {0: 1, 1: 0, 2: 0, 3: 25, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!